165 lines
5.8 KiB
HTML
165 lines
5.8 KiB
HTML
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN">
|
|
|
|
<html>
|
|
<head>
|
|
<title>BankIt Submission Help: Primers</title>
|
|
<link rel="stylesheet" href="../../css/bankit.13.6.css" type="text/css">
|
|
<link rel="stylesheet" type="text/css" href="../../css/sp_3_74_ncbi_header.13.6.css">
|
|
<link rel="stylesheet" type="text/css" href="../../css/sp_1_82_layout.13.6.css">
|
|
<body class="help">
|
|
<header id="ncbi_header" class="ncbi-header" role="banner">
|
|
<div class="usa-grid">
|
|
<div class="usa-width-one-whole">
|
|
<div class="ncbi-header__logo">
|
|
<a href="https://www.ncbi.nlm.nih.gov/" class="logo" aria-label="NCBI Logo"
|
|
data-ga-action="click_image" data-ga-label="NIH NLM Logo">
|
|
<img src="https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg"
|
|
alt="NIH NLM Logo">
|
|
</a>
|
|
</div>
|
|
</div>
|
|
</div>
|
|
</header>
|
|
|
|
<h1>BankIt Submission Help: Primers</h1>
|
|
|
|
<div class="border1"><p>BankIt Submission tool requires the submitter to identify the forward and reverse primers used to determine the sequences of the set.</p>
|
|
|
|
<p>Primers may be identified by their commercial names, their sequences, or both.</p>
|
|
<p>Primer sequences should be presented in 5' > 3' order. The sequences should be given in the
|
|
<a href="http://www.insdc.org/documents/feature-table#7.4.1">IUPAC</a>
|
|
degenerate-base alphabet,
|
|
except for the <a
|
|
href="http://www.insdc.org/documents/feature-table#7.4.2">modified
|
|
(extended) bases</a>;
|
|
those must be enclosed within angle brackets <>. For example
|
|
<strong>ACACAG<i>GTACAC</strong>.</p>
|
|
|
|
|
|
<h2>Indicating Multiple Primer Reactions</h2>
|
|
<p>When more than one forward and/or reverse primer reactions are performed to
|
|
determine a sequence, separate the sequences of each primer reaction with
|
|
commas and enclose all of them in parentheses. For example,
|
|
<code><strong>(GACGTTGTAAAACGACGGCC, TGTAAAACGACGGCCAGT, TATGGGTCCAGT)</strong></code>.</p>
|
|
|
|
<h2>Indicating Multiple Primers within a Reaction</h2>
|
|
<p>When more than one forward and/or reverse primer is used in a single reaction
|
|
to determine a sequence,
|
|
separate the sequences of each primer with colons. For example,
|
|
<code><strong>ACGTGACGTTGTAAAACGACGGCC:ACACTGTAAAACGACGGCCAGT:TATGGGTCCAGTTTT</strong></code>.</p>
|
|
<p>
|
|
|
|
<h2>Indicating Different Primers</h2>
|
|
|
|
<p>If the sequences in a set were determined using different primers, the
|
|
primers used to determine the largest number of the sequences can be identified
|
|
in the Primers - 'Set One Value' section of the submission tool and
|
|
alternate primers can be identified in the primers table. Table column
|
|
headers to list alternate primers are shown below.</p>
|
|
|
|
<table class="example">
|
|
<tr>
|
|
<td>Primer</td>
|
|
<td>Column Header</td>
|
|
</tr>
|
|
<tr>
|
|
<td>Forward primer name</td>
|
|
<td>fwd_primer_name</td>
|
|
</tr>
|
|
<tr>
|
|
<td>Forward primer sequence</td>
|
|
<td>fwd_primer_seq</td>
|
|
</tr>
|
|
<tr>
|
|
<td>Reverse primer name</td>
|
|
<td>rev_primer_name</td>
|
|
</tr>
|
|
<tr>
|
|
<td>Reverse primer sequence</td>
|
|
<td>rev_primer_seq</td>
|
|
</tr>
|
|
</table>
|
|
</div>
|
|
<h2>Entering Primers in the Primers Table</h2>
|
|
|
|
<div class="border1">
|
|
<p>When different primers are used for determining
|
|
sequences in a BankIt Set, enter the set of forward and reverse primers
|
|
most frequently used in the Primers - 'Set One Value' section of
|
|
the submission tool. Then use the primers table to indicate
|
|
alternate primer sequences. The BankIt submission tool will use the
|
|
primer values from the Primers page for any blanks in a primer column in
|
|
the primers table. A sample primers table is show below. <br />
|
|
<strong>Note:</strong>
|
|
<ul>
|
|
<li> Seq4 shows an example for multiple forward and reverse primers within a
|
|
reaction.</li>
|
|
<li>Seq6 shows an example for multiple reverse primer reactions.</li>
|
|
<li> Seq7 shows an example for multiple forward primer reactions and
|
|
multiple primers within a reaction. </li>
|
|
</ul>
|
|
</p>
|
|
|
|
<table border="0" cellspacing="0" cellpadding="5">
|
|
<caption>Sample Primers Table </caption>
|
|
<tr>
|
|
<td nowrap> Sequence_ID </td>
|
|
<td nowrap> fwd_primer_seq </td>
|
|
<td nowrap> rev_primer_seq </td>
|
|
<td nowrap> fwd_primer_name </td>
|
|
<td nowrap> rev_primer_name </td>
|
|
</tr>
|
|
<tr>
|
|
<td nowrap> Seq1 </td>
|
|
<td nowrap> GACGTTGTAAAACGACGGCC </td>
|
|
<td nowrap> CACAGGAAACAGCTATGACC </td>
|
|
<td nowrap> COX_forward </td>
|
|
<td nowrap> COX_reverse </td>
|
|
</tr>
|
|
<tr>
|
|
<td nowrap> Seq2 </td>
|
|
<td nowrap> TGTAAAACGACGGCCAGT </td>
|
|
<td nowrap> CAGGAAACAGCTATGACC </td>
|
|
<td nowrap> COX_forward </td>
|
|
<td nowrap> COX_reverse </td>
|
|
</tr>
|
|
<tr>
|
|
<td nowrap> Seq3 </td>
|
|
<td nowrap> </td>
|
|
<td nowrap> </td>
|
|
<td nowrap> COX_forward </td>
|
|
<td nowrap> COX_reverse </td>
|
|
</tr>
|
|
<tr>
|
|
<td nowrap> Seq4 </td>
|
|
<td nowrap> TAATACGACTCACTATAGGG:TGTAAACACACACACAGGTT </td>
|
|
<td nowrap> ATTTAGGTGACACTATAG:CAGTGACACACACGTACA </td>
|
|
<td nowrap> COX_forward </td>
|
|
<td nowrap> COX_reverse </td>
|
|
</tr>
|
|
<tr>
|
|
<td nowrap> Seq5 </td>
|
|
<td nowrap> </td>
|
|
<td nowrap> </td>
|
|
<td nowrap> COX_forward </td>
|
|
<td nowrap> COX_reverse </td>
|
|
</tr>
|
|
<tr>
|
|
<td nowrap> Seq6 </td>
|
|
<td nowrap> GACGTTGTAAAACGACGGCC </td>
|
|
<td nowrap> (CAGGAAACAGCTATGACC,TGTAAAACGACGGCCAGT) </td>
|
|
<td nowrap> COX_forward </td>
|
|
<td nowrap> COX_reverse </td>
|
|
</tr>
|
|
<tr>
|
|
<td nowrap> Seq7 </td>
|
|
<td nowrap>
|
|
(CAGGAAACAGCTATGACC:ATTTAGGTGACACTATAG,GACGTTGTAACGACCGGAA:TTTTTCACAGTACGTTACT) </td>
|
|
<td nowrap> TGTAAAACGACGGCCAGT </td>
|
|
<td nowrap> COX_forward </td>
|
|
<td nowrap> COX_reverse </td>
|
|
</tr>
|
|
</table>
|
|
</div>
|
|
</body>
|
|
</html>
|