nih-gov/www.ncbi.nlm.nih.gov/WebSub/html/help/primers.html

165 lines
5.8 KiB
HTML

<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN">
<html>
<head>
<title>BankIt Submission Help: Primers</title>
<link rel="stylesheet" href="../../css/bankit.13.6.css" type="text/css">
<link rel="stylesheet" type="text/css" href="../../css/sp_3_74_ncbi_header.13.6.css">
<link rel="stylesheet" type="text/css" href="../../css/sp_1_82_layout.13.6.css">
<body class="help">
<header id="ncbi_header" class="ncbi-header" role="banner">
<div class="usa-grid">
<div class="usa-width-one-whole">
<div class="ncbi-header__logo">
<a href="https://www.ncbi.nlm.nih.gov/" class="logo" aria-label="NCBI Logo"
data-ga-action="click_image" data-ga-label="NIH NLM Logo">
<img src="https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg"
alt="NIH NLM Logo">
</a>
</div>
</div>
</div>
</header>
<h1>BankIt Submission Help: Primers</h1>
<div class="border1"><p>BankIt Submission tool requires the submitter to identify the forward and reverse primers used to determine the sequences of the set.</p>
<p>Primers may be identified by their commercial names, their sequences, or both.</p>
<p>Primer sequences should be presented in 5' &gt; 3' order. The sequences should be given in the
<a href="http://www.insdc.org/documents/feature-table#7.4.1">IUPAC</a>
degenerate-base alphabet,
except for the <a
href="http://www.insdc.org/documents/feature-table#7.4.2">modified
(extended) bases</a>;
those must be enclosed within angle brackets &lt;&gt;. For example
<strong>ACACAG&lt;i&gt;GTACAC</strong>.</p>
<h2>Indicating Multiple Primer Reactions</h2>
<p>When more than one forward and/or reverse primer reactions are performed to
determine a sequence, separate the sequences of each primer reaction with
commas and enclose all of them in parentheses. For example,
<code><strong>(GACGTTGTAAAACGACGGCC, TGTAAAACGACGGCCAGT, TATGGGTCCAGT)</strong></code>.</p>
<h2>Indicating Multiple Primers within a Reaction</h2>
<p>When more than one forward and/or reverse primer is used in a single reaction
to determine a sequence,
separate the sequences of each primer with colons. For example,
<code><strong>ACGTGACGTTGTAAAACGACGGCC:ACACTGTAAAACGACGGCCAGT:TATGGGTCCAGTTTT</strong></code>.</p>
<p>
<h2>Indicating Different Primers</h2>
<p>If the sequences in a set were determined using different primers, the
primers used to determine the largest number of the sequences can be identified
in the Primers - 'Set One Value' section of the submission tool and
alternate primers can be identified in the primers table. Table column
headers to list alternate primers are shown below.</p>
<table class="example">
<tr>
<td>Primer</td>
<td>Column Header</td>
</tr>
<tr>
<td>Forward primer name</td>
<td>fwd_primer_name</td>
</tr>
<tr>
<td>Forward primer sequence</td>
<td>fwd_primer_seq</td>
</tr>
<tr>
<td>Reverse primer name</td>
<td>rev_primer_name</td>
</tr>
<tr>
<td>Reverse primer sequence</td>
<td>rev_primer_seq</td>
</tr>
</table>
</div>
<h2>Entering Primers in the Primers Table</h2>
<div class="border1">
<p>When different primers are used for determining
sequences in a BankIt Set, enter the set of forward and reverse primers
most frequently used in the Primers - 'Set One Value' section of
the submission tool. Then use the primers table to indicate
alternate primer sequences. The BankIt submission tool will use the
primer values from the Primers page for any blanks in a primer column in
the primers table. A sample primers table is show below. <br />
<strong>Note:</strong>
<ul>
<li> Seq4 shows an example for multiple forward and reverse primers within a
reaction.</li>
<li>Seq6 shows an example for multiple reverse primer reactions.</li>
<li> Seq7 shows an example for multiple forward primer reactions and
multiple primers within a reaction. </li>
</ul>
</p>
<table border="0" cellspacing="0" cellpadding="5">
<caption>Sample Primers Table </caption>
<tr>
<td nowrap> Sequence_ID </td>
<td nowrap> fwd_primer_seq </td>
<td nowrap> rev_primer_seq </td>
<td nowrap> fwd_primer_name </td>
<td nowrap> rev_primer_name </td>
</tr>
<tr>
<td nowrap> Seq1 </td>
<td nowrap> GACGTTGTAAAACGACGGCC </td>
<td nowrap> CACAGGAAACAGCTATGACC </td>
<td nowrap> COX_forward </td>
<td nowrap> COX_reverse </td>
</tr>
<tr>
<td nowrap> Seq2 </td>
<td nowrap> TGTAAAACGACGGCCAGT </td>
<td nowrap> CAGGAAACAGCTATGACC </td>
<td nowrap> COX_forward </td>
<td nowrap> COX_reverse </td>
</tr>
<tr>
<td nowrap> Seq3 </td>
<td nowrap> </td>
<td nowrap> </td>
<td nowrap> COX_forward </td>
<td nowrap> COX_reverse </td>
</tr>
<tr>
<td nowrap> Seq4 </td>
<td nowrap> TAATACGACTCACTATAGGG:TGTAAACACACACACAGGTT </td>
<td nowrap> ATTTAGGTGACACTATAG:CAGTGACACACACGTACA </td>
<td nowrap> COX_forward </td>
<td nowrap> COX_reverse </td>
</tr>
<tr>
<td nowrap> Seq5 </td>
<td nowrap> </td>
<td nowrap> </td>
<td nowrap> COX_forward </td>
<td nowrap> COX_reverse </td>
</tr>
<tr>
<td nowrap> Seq6 </td>
<td nowrap> GACGTTGTAAAACGACGGCC </td>
<td nowrap> (CAGGAAACAGCTATGACC,TGTAAAACGACGGCCAGT) </td>
<td nowrap> COX_forward </td>
<td nowrap> COX_reverse </td>
</tr>
<tr>
<td nowrap> Seq7 </td>
<td nowrap>
(CAGGAAACAGCTATGACC:ATTTAGGTGACACTATAG,GACGTTGTAACGACCGGAA:TTTTTCACAGTACGTTACT) </td>
<td nowrap> TGTAAAACGACGGCCAGT </td>
<td nowrap> COX_forward </td>
<td nowrap> COX_reverse </td>
</tr>
</table>
</div>
</body>
</html>