publicdata/nih-gov
1
0
Fork 0
Code Issues Pull requests Projects Releases Packages Wiki Activity Actions
nih-gov/www.ncbi.nlm.nih.gov/HTGS/sequininfo.html

651 lines
43 KiB
HTML
Raw Permalink Blame History

<?xml version="1.0" encoding="utf-8"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head><meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<!-- AppResources meta begin -->
<meta name="paf-app-resources" content="" />
<!-- AppResources meta end -->
<!-- TemplateResources meta begin -->
<meta name="paf_template" content="StdNCol" />
<!-- TemplateResources meta end -->
<!-- Page meta begin -->
<!-- Page meta end -->
<!-- Logger begin -->
<meta xmlns:ncbi-portal="http://ncbi.gov/portal/XSLT/namespace" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" name="ncbi_app" content="genbank" /><meta xmlns:ncbi-portal="http://ncbi.gov/portal/XSLT/namespace" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" name="ncbi_pdid" content="custom-page" />
<!-- Logger end -->
<title>Using Sequin to Prepare a HTG Submission</title>
<!-- PageFixtures headcontent begin -->
<meta name="cms-local-nav-url" content="https://cms.ncbi.nlm.nih.gov//genbank/_nav" />
<!-- PageFixtures headcontent end -->
<!-- AppResources external_resources begin -->
<script type="text/javascript" src="/core/jig/1.15.6/js/jig.min.js"></script>
<!-- AppResources external_resources end -->
<!-- Page headcontent begin -->
<meta name="subsite" content="genbank" />
<meta name="path" content="genbank/htgs/sequininfo" />
<meta name="modified" content="2017-11-20T22:51:52Z" /><meta xmlns:ncbi-portal="http://ncbi.gov/portal/XSLT/namespace" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" name="cms-edit-aux-url" content="http://cms.ncbi.nlm.nih.gov/node//edit" />
<!-- Page headcontent end -->
<!-- PageFixtures resources begin -->
<link xmlns="http://www.w3.org/1999/xhtml" type="text/css" rel="stylesheet" href="//static.pubmed.gov/portal/portal3rc.fcgi/4218191/css/4207974/4206132.css" xml:base="http://127.0.0.1/sites/static/header_footer" />
<!-- PageFixtures resources end -->
<link rel="shortcut icon" href="//www.ncbi.nlm.nih.gov/favicon.ico" /><meta name="ncbi_phid" content="CE8EFDBB7C8B97E10000000000FA00D0.m_5" />
<meta name='referrer' content='origin-when-cross-origin'/><link type="text/css" rel="stylesheet" href="//static.pubmed.gov/portal/portal3rc.fcgi/4218137/css/4121862/3974050/3917732/251717/4108189/14534/45193/3534283/4128070/3407145/4005757/4062871.css" /><link type="text/css" rel="stylesheet" href="//static.pubmed.gov/portal/portal3rc.fcgi/4218137/css/3529741/3529739.css" media="print" /></head>
<body class=" col2 custom-page">
<div class="grid">
<div class="col twelve_col nomargin shadow">
<!-- System messages like service outage or JS required; this is handled by the TemplateResources portlet -->
<div class="sysmessages">
<noscript>
<p class="nojs">
<strong>Warning:</strong>
The NCBI web site requires JavaScript to function.
<a href="/guide/browsers/#enablejs" title="Learn how to enable JavaScript" target="_blank">more...</a>
</p>
</noscript>
</div>
<!--/.sysmessage-->
<div class="wrap">
<div class="page">
<div xmlns:xi="http://www.w3.org/2001/XInclude">
<div xmlns="http://www.w3.org/1999/xhtml" id="universal_header" xml:base="http://127.0.0.1/sites/static/header_footer">
<section class="usa-banner">
<div class="usa-accordion">
<header class="usa-banner-header">
<div class="usa-grid usa-banner-inner">
<img src="https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/favicons/favicon-57.png" alt="U.S. flag" />
<p>An official website of the United States government</p>
<button class="non-usa-accordion-button usa-banner-button" aria-expanded="false" aria-controls="gov-banner-top" type="button">
<span class="usa-banner-button-text">Here's how you know</span>
</button>
</div>
</header>
<div class="usa-banner-content usa-grid usa-accordion-content" id="gov-banner-top" aria-hidden="true">
<div class="usa-banner-guidance-gov usa-width-one-half">
<img class="usa-banner-icon usa-media_block-img" src="https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-dot-gov.svg" alt="Dot gov" />
<div class="usa-media_block-body">
<p>
<strong>The .gov means it's official.</strong>
<br />
Federal government websites often end in .gov or .mil. Before
sharing sensitive information, make sure you're on a federal
government site.
</p>
</div>
</div>
<div class="usa-banner-guidance-ssl usa-width-one-half">
<img class="usa-banner-icon usa-media_block-img" src="https://www.ncbi.nlm.nih.gov/coreutils/uswds/img/icon-https.svg" alt="Https" />
<div class="usa-media_block-body">
<p>
<strong>The site is secure.</strong>
<br />
The <strong>https://</strong> ensures that you are connecting to the
official website and that any information you provide is encrypted
and transmitted securely.
</p>
</div>
</div>
</div>
</div>
</section>
<div class="usa-overlay"></div>
<header class="ncbi-header" role="banner" data-section="Header">
<div class="usa-grid">
<div class="usa-width-one-whole">
<div class="ncbi-header__logo">
<a href="/" class="logo" aria-label="NCBI Logo" data-ga-action="click_image" data-ga-label="NIH NLM Logo">
<img src="https://www.ncbi.nlm.nih.gov/coreutils/nwds/img/logos/AgencyLogo.svg" alt="NIH NLM Logo" />
</a>
</div>
<div class="ncbi-header__account">
<a id="account_login" href="https://account.ncbi.nlm.nih.gov" class="usa-button header-button" style="display:none" data-ga-action="open_menu" data-ga-label="account_menu">Log in</a>
<button id="account_info" class="header-button" style="display:none" aria-controls="account_popup" type="button">
<span class="fa fa-user" aria-hidden="true">
<svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 24 24" width="20px" height="20px">
<g style="fill: #fff">
<ellipse cx="12" cy="8" rx="5" ry="6"></ellipse>
<path d="M21.8,19.1c-0.9-1.8-2.6-3.3-4.8-4.2c-0.6-0.2-1.3-0.2-1.8,0.1c-1,0.6-2,0.9-3.2,0.9s-2.2-0.3-3.2-0.9 C8.3,14.8,7.6,14.7,7,15c-2.2,0.9-3.9,2.4-4.8,4.2C1.5,20.5,2.6,22,4.1,22h15.8C21.4,22,22.5,20.5,21.8,19.1z"></path>
</g>
</svg>
</span>
<span class="username desktop-only" aria-hidden="true" id="uname_short"></span>
<span class="sr-only">Show account info</span>
</button>
</div>
<div class="ncbi-popup-anchor">
<div class="ncbi-popup account-popup" id="account_popup" aria-hidden="true">
<div class="ncbi-popup-head">
<button class="ncbi-close-button" data-ga-action="close_menu" data-ga-label="account_menu" type="button">
<span class="fa fa-times">
<svg xmlns="http://www.w3.org/2000/svg" viewBox="0 0 48 48" width="24px" height="24px">
<path d="M38 12.83l-2.83-2.83-11.17 11.17-11.17-11.17-2.83 2.83 11.17 11.17-11.17 11.17 2.83 2.83 11.17-11.17 11.17 11.17 2.83-2.83-11.17-11.17z"></path>
</svg>
</span>
<span class="usa-sr-only">Close</span></button>
<h4>Account</h4>
</div>
<div class="account-user-info">
Logged in as:<br />
<b><span class="username" id="uname_long">username</span></b>
</div>
<div class="account-links">
<ul class="usa-unstyled-list">
<li><a id="account_myncbi" href="/myncbi/" class="set-base-url" data-ga-action="click_menu_item" data-ga-label="account_myncbi">Dashboard</a></li>
<li><a id="account_pubs" href="/myncbi/collections/bibliography/" class="set-base-url" data-ga-action="click_menu_item" data-ga-label="account_pubs">Publications</a></li>
<li><a id="account_settings" href="/account/settings/" class="set-base-url" data-ga-action="click_menu_item" data-ga-label="account_settings">Account settings</a></li>
<li><a id="account_logout" href="/account/signout/" class="set-base-url" data-ga-action="click_menu_item" data-ga-label="account_logout">Log out</a></li>
</ul>
</div>
</div>
</div>
</div>
</div>
</header>
<div role="navigation" aria-label="access keys">
<a id="nws_header_accesskey_0" href="https://www.ncbi.nlm.nih.gov/guide/browsers/#ncbi_accesskeys" class="usa-sr-only" accesskey="0" tabindex="-1">Access keys</a>
<a id="nws_header_accesskey_1" href="https://www.ncbi.nlm.nih.gov" class="usa-sr-only" accesskey="1" tabindex="-1">NCBI Homepage</a>
<a id="nws_header_accesskey_2" href="/myncbi/" class="set-base-url usa-sr-only" accesskey="2" tabindex="-1">MyNCBI Homepage</a>
<a id="nws_header_accesskey_3" href="#maincontent" class="usa-sr-only" accesskey="3" tabindex="-1">Main Content</a>
<a id="nws_header_accesskey_4" href="#" class="usa-sr-only" accesskey="4" tabindex="-1">Main Navigation</a>
</div>
<section data-section="Alerts">
<div class="ncbi-alerts-placeholder"></div>
</section>
</div>
</div>
<!--/.header-->
<div class="header">
<div class="res_logo"><h1 class="res_name"><a href="/genbank/" title="GenBank home">GenBank</a></h1><h2 class="res_tagline">Public nucleic acid sequence repository</h2></div>
<div class="search"><form method="get" action="/nuccore/"><div class="search_form"><label for="database" class="offscreen_noflow">Search database</label><select id="database"><optgroup label="Recent"><option value="nuccore" selected="selected">Nucleotide</option><option value="books">Books</option><option value="biosample">BioSample</option><option value="pubmed" class="last">PubMed</option></optgroup><optgroup label="All"><option value="gquery">All Databases</option><option value="assembly">Assembly</option><option value="biocollections">Biocollections</option><option value="bioproject">BioProject</option><option value="biosample">BioSample</option><option value="books">Books</option><option value="clinvar">ClinVar</option><option value="cdd">Conserved Domains</option><option value="gap">dbGaP</option><option value="dbvar">dbVar</option><option value="gene">Gene</option><option value="genome">Genome</option><option value="gds">GEO DataSets</option><option value="geoprofiles">GEO Profiles</option><option value="gtr">GTR</option><option value="ipg">Identical Protein Groups</option><option value="medgen">MedGen</option><option value="mesh">MeSH</option><option value="nlmcatalog">NLM Catalog</option><option value="nuccore">Nucleotide</option><option value="omim">OMIM</option><option value="pmc">PMC</option><option value="protein">Protein</option><option value="proteinclusters">Protein Clusters</option><option value="protfam">Protein Family Models</option><option value="pcassay">PubChem BioAssay</option><option value="pccompound">PubChem Compound</option><option value="pcsubstance">PubChem Substance</option><option value="pubmed">PubMed</option><option value="snp">SNP</option><option value="sra">SRA</option><option value="structure">Structure</option><option value="taxonomy">Taxonomy</option><option value="toolkit">ToolKit</option><option value="toolkitall">ToolKitAll</option><option value="toolkitbookgh">ToolKitBookgh</option></optgroup></select><div class="nowrap"><label for="term" class="offscreen_noflow" accesskey="/">Search term</label><div class="nowrap"><input type="text" name="term" id="term" title="Search Nucleotide" value="" class="jig-ncbiclearbutton jig-ncbiautocomplete" data-jigconfig="isEnabled:false,disableUrl:'NcbiSearchBarAutoComplCtrl'" autocomplete="off" data-sbconfig="ds:'no',pjs:'no',afs:'yes'" /></div><button id="search" type="submit" class="button_search nowrap" cmd="go">Search</button></div></div></form></div>
</div>
<div class="nav_and_browser">
<div class="localnav"><ul class="jig-ncbilocalnav">
<li><a href="#">GenBank</a><ul>
<li><a href="/genbank/">About GenBank</a></li>
<li><a href="/genbank/submit_types">Submission Types</a></li>
<li><a href="/genbank/submit">Submission Tools</a></li>
<li><a href="/genbank/update">Update GenBank Records</a></li>
<li><a href="/nuccore/">Search</a></li>
<li><a href="/BLAST/Blast.cgi?CMD=Web&amp;PAGETYPE=BLASTHome">BLAST</a></li>
<li><a href="/genbank/statistics">Statistics</a></li>
<li><a href="/genbank/samplerecord/">Sample Record</a></li>
<li><a href="/genbank/sequencerevisionhistory/">Revision History</a></li>
<li><a href="/genbank/sequenceids/">Sequence IDs</a></li>
</ul>
</li>
<li><a href="#">Submit</a><ul>
<li><a href="/genbank/submit">Submission Tools</a></li>
<li><a href="/genbank/submit_types">Submission Types</a></li>
<li><a href="/WebSub/?tool=genbank">BankIt</a></li>
<li><a href="/genbank/table2asn">table2asn</a></li>
<li><a href="https://www.ncbi.nlm.nih.gov/sra/docs/sequence-data-processing">Sequence Data Processing</a></li>
</ul>
</li>
<li><a href="#">Genomes</a><ul>
<li><a href="/genbank/genomesubmit">Complete Genome Submission Guide</a></li>
<li><a href="/genbank/genomesubmit_annotation">Prokaryotic Genome Annotation Guide</a></li>
<li><a href="/genbank/eukaryotic_genome_submission_annotation">Eukaryotic Genome Annotation Guide</a></li>
<li><a href="/genbank/examples.wgs">Annotation Examples</a></li>
<li><a href="https://submit.ncbi.nlm.nih.gov/subs/wgs/">Genome Submission Portal</a></li>
</ul>
</li>
<li><a title="Whole Genome Shotgun sequences and submissions" href="#">WGS</a><ul>
<li><a href="/genbank/wgs">About WGS</a></li>
<li><a href="/Traces/wgs">WGS Project List</a></li>
<li><a href="/genbank/wgs.submit">WGS Submission Guide</a></li>
<li><a href="/genbank/wgsfaq/">FAQ</a></li>
<li><a href="https://submit.ncbi.nlm.nih.gov/subs/wgs/">Genome Submission Portal</a></li>
<li><a href="/genbank/eukaryotic_genome_submission_annotation">Eukaryotic Annotation Guide</a></li>
<li><a href="/genbank/genomesubmit_annotation">Prokaryotic Annotation Guide</a></li>
<li><a href="/genbank/asndisc">Discrepancy Report</a></li>
<li><a href="/assembly/agp/AGP_Specification/">AGP format</a></li>
</ul>
</li>
<li><a href="#">Metagenomes</a><ul>
<li><a href="/genbank/metagenome">About Metagenomes</a></li>
<li><a href="/genbank/structuredcomment">Structured Comment</a></li>
</ul>
</li>
<li><a href="#">TPA</a><ul>
<li><a href="/genbank/TPA">About TPA</a></li>
<li><a href="/genbank/tpafaq">FAQ</a></li>
<li><a href="/genbank/TPA-Exp">TPA-Exp</a></li>
<li><a href="/genbank/TPA-Inf">TPA-Inf</a></li>
</ul>
</li>
<li><a href="#">TSA</a><ul>
<li><a href="/genbank/TSA">About TSA</a></li>
<li><a href="/genbank/TSAguide">TSA Submission Guide</a></li>
<li><a href="/genbank/TSAfaq">FAQ</a></li>
</ul>
</li>
<li><a href="#">INSDC</a><ul>
<li><a href="/genbank/collab">About INSDC</a></li>
<li><a href="/genbank/collab/country">Geographic Location Name List</a></li>
<li><a href="/genbank/collab/db_xref">db_xref List</a></li>
<li><a href="http://www.insdc.org/documents/feature_table.html">Feature Table</a></li>
</ul>
</li>
<li><a href="#">Documentation</a><ul>
<li><a href="https://www.ncbi.nlm.nih.gov/sra/docs/sequence-data-processing/">Sequence Data Processing</a></li>
<li><a href="/genbank/submission_brokers">Submission Brokers</a></li>
<li><a href="/genbank/acc_prefix">Accession Number Prefixes</a></li>
<li><a href="/genbank/organelle_submit/">Organelle Submission Guide</a></li>
<li><a href="/genbank/monkeypox_submission/">Monkeypox Submission Guide</a></li>
<li><a href="/genbank/validation/">Common Submission Errors</a> </li>
<li><a href="/genbank/sequencecheck/">Ribosomal Submission Errors</a></li>
<li><a href="/genbank/sequencecheck/virus">Common Sequence Errors</a></li>
<li><a href="https://support.nlm.nih.gov/knowledgebase/category/?id=CAT-01240">Submission FAQs</a></li>
</ul>
</li>
<li><a href="#">Other</a><ul>
<li><a href="/genbank/htgs">About HTGs</a></li>
<li><a href="/genbank/dbest">About EST</a></li>
<li><a href="/genbank/dbgss">About GSS</a></li>
<li><a href="/genbank/tls">About TLS</a></li>
<li><a href="/genbank/tlsguide">Submit TLS</a></li>
</ul>
</li>
</ul></div>
</div>
<!-- was itemctrl -->
<div class="container">
<div id="maincontent" class="content col twelve_col last">
<div class="col1">
<h2 id="using-sequin-to-prepare-a-htg-su">Using Sequin to Prepare a HTG Submission</h2>
<p>This document assumes that you are already familiar with the Sequin program. If you are not, please visit the Sequin home page at <a href="//www.ncbi.nlm.nih.gov/Sequin">www.ncbi.nlm.nih.gov/Sequin</a>. <strong>PLEASE NOTE Sequin will soon be retired as a submission tool</strong>. If you are currently using Sequin for your HTG submissions, you should switch to <a href="https://www.ncbi.nlm.nih.gov/genbank/htgs/tbl2asninfo/">tbl2asn</a>.</p>
<h2 id="configuring-sequin-for-htg-submi">Configuring Sequin for HTG Submissions</h2>
<p>In order to create HTG records in Sequin, you must add some information to the active Sequin configuration file, which is not the configuration file that may be included when you download Sequin. The config files in the config directory in the Sequin archive are copies that need to be moved to the right place in order to work. In Unix, the active configuration file is called .sequinrc, on the Macintosh it is called sequin.cnf, and on the PC it is called sequin.ini. To the active config file, add the lines</p>
<pre><code>[SETTINGS]
GENOMECENTER=genome_center_abbreviation
</code></pre>
<p>where genome_center_abbreviation is usually your FTP login name. If there is already a section called [SETTINGS] in the configuration file, add the GENOMECENTER to the list.</p>
<p>For the PC, the only active config file is in the "Windows" directory. This file can have different names, such as WINNT, depending upon which version of Microsoft Windows is being used. The easiest way to find the active config file is to download the Sequin archive, extract it, run sequin.exe, choose Misc-&gt;Net Configure, click on Normal, press Accept, and then Quit Program. This should save a sequin.ini file in the correct place. You should then search for sequin.ini. Once you find the right sequin.ini file, you should edit that one.</p>
<p>If you are using a MAC, then the active config file is the sequin.cnf file in the "System Folder:Preferences" folder, not the one in the "Sequin Folder:config" folder. Furthermore, any config file in the "System Folder" itself will override the normal one, so you need to edit the one in "System Folder:Preferences". If there isn't a file there already, you can move the one from the "Sequin Folder:contig" folder, even if you have already edited this file.</p>
<p>Be sure to do the editing while Sequin isn't running so that your changes are not overwritten when you quit Sequin. When you restart Sequin, there will be a new button on the first Welcome to Sequin form called "New FA2HTGS Submission". If you have previously set up the configuration file with the GENOMETAG setting and you see this button in Sequin, there is no need to change anything.</p>
<h2 id="creating-a-sequin-submission-tem">Creating a Sequin Submission Template File</h2>
<p>Before you create your first HTG submission, you need to make a Sequin submission template that contains contact, citation, and organism information. You can then use this template for subsequent submissions.</p>
<p>To create the template, click on the "Start New Submission" button on the first Welcome to Sequin form. All of the information from the subsequent Submitting Authors form will be used for the HTG record. Fill out the Submission, Contact, Authors, and Affiliation pages carefully. Instructions are provided in the Sequin <a href="https://www.ncbi.nlm.nih.gov/Sequin/sequin.hlp.html#SubmittingAuthorsForm">help</a> documentation. On the Sequence Format form, select Single sequence and FASTA format. On the next form, Organism and Sequences, the only information that will be read into the HTG record is the name of the organism. Select the scientific name on the Organism page, and import a dummy nucleotide sequence on the Nucleotide page. This sequence will not be included in any submissions, therefore, any sequence, even just one nucleotide, is sufficient. There is no need to provide any Protein information. When you reach the record viewer (the GenBank flatfile view), save the file and close the window.</p>
<h2 id="formatting-sequences-in-fasta-fo">Formatting Sequences in FASTA Format</h2>
<p>Single, unsegmented (i.e. no gaps) sequences should be in standard FASTA format. Segmented sequences containing <strong>unknown length</strong> gaps for phase 0, 1, or 2 HTGS should be in a modified FASTA format such as this:</p>
<pre><code>&gt;P74A8 [chromosome=2] [clone=ABC12345]
gatcagcccaaagcattgattaggggaacttacctgtagagggctgcagcaatggggaac
acctggctgggtcacagagtggtcaatgcactccatgacttttgggtcaggacacagaaa
gaaagagcggggaaccggggggccctacagtgatgaattatactaactgattttagaatg
&gt;segment2
ttaaacaaacattgcatttccagaataaaccccatttagtaacgcatagtgtgcttgtat
ctcagcctcccaaagtgctgggattatagacatgagccagcgcacctggctttgttagcc
&gt;segment3
ttttcaaataactttttgaactttgttaattttttaattgcacgttttctccttcattta
ctaattccattcaaaagtagcatcaatgagaataaattacttaggaatacatttaattaa
aaagtgctagacttgtacactgaaaattacaaagtactctggagatatattc
</code></pre>
<p>The first line has the Sequence Id (=SeqID or sequence name), P74A8, and source information. Each segment is separated by-</p>
<p>&gt;segmentx</p>
<p>This line must be unique among all the lines of FASTA-formatted sequence being processed (e.g., "&gt;segment2", "&gt;segment3", etc).</p>
<p>It is possible to submit sequences containing <strong>known length gaps</strong> or a <strong>mix of known and unknown length gaps</strong>, however you must modify the fasta file to correctly format this. The fasta file should be set up to contain runs of internal N's to represent the gaps. Use a run of exactly 100 N's to represent each unknown length gap. For known length gaps use a run of N's that corresponds to the exact length of the gap. For example if you know the gaps is 16 bp long, you would insert 16 N's. Sequin will mark runs of N's great than 10 and not equal to 100 as estimated length gaps and runs of 100 N's will be represented as unknown length gaps.</p>
<pre><code>&gt;P74A8 [chromosome=2] [clone=ABC12345]
gatcagcccaaagcattgattaggggaacttacctgtagagggctgcagcaatggggaac
acctggctgggtcacagagtggtcaatgcactccatgacttttgggtcaggacacagaaa
gaaagagcggggaaccggggggccctacagtgatgaattatactaactgattttagaatg
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttaaacaaacattgcatttc
cagaataaaccccatttagtaacgcatagtgtgcttgtatctcagcctcccaaagtgctgg
gattatagacatgagccagcgcacctggctttgttagccnnnnnnnnnnnnnnnnttttca
aataactttttgaactttgttaattttttaattgcacgttttctccttcatttactaattc
cattcaaaagtagcatcaatgagaataaattacttaggaatacatttaattaaaaagtgct
gacttgtacactgaaaattacaaagtactctggagatatattc
</code></pre>
<h2 id="formatting-ace-sequences-from-ph">Formatting Ace Sequences from Phrap</h2>
<p>You can also import sequence files in the .ace file format, which is an output of Phrap. This format is not described here.</p>
<h2 id="creating-the-htg-record">Creating the HTG Record</h2>
<p>On the Welcome to Sequin form, select "New FA2HTGS Submission" if you are submitting sequences in FASTA format, and "New PHRAP Submission" if you are submitting sequences in PHRAP .ace format. On the next page, click on "Read Seq-submit template" to import the Sequin submission template file. Next, read in the FASTA or PHRAP-formatted sequence file. On the final page, enter details about the record.</p>
<ul>
<li>
<p>Phase</p>
<p>HTGS-0: Single-pass or a few-pass reads of a single clone. A phase 0 record, in general, does not have contigs.</p>
<p>HTGS-1: A collection of unordered contigs with gaps of unknown length. A phase 1 record must at the very least have two segments with one gap.</p>
<p>HTGS-2: A series of ordered contigs whose relative orientation is known. The gap lengths may or may not be known. This could even be a single sequence without gaps if the sequence has ambiguities that will be resolved.</p>
<p>HTGS-3: A single contiguous sequence with no gaps. This sequence is finished, although it may or may not be annotated.</p>
</li>
<li>
<p>Draft</p>
<p>Check this box if the sequence is a DRAFT-quality sequence.</p>
</li>
<li>
<p>Organism</p>
<p>This field was read in from the Sequin submission template.</p>
</li>
<li>
<p>Sequence name</p>
<p>The sequence must have a name that is unique within the genome center. The NCBI uses the combination of the genome center name and the sequence name to track this sequence and to talk to you about it. The name can have any form you like but must be unique within your center. The name can be the same as the clone name, but does not have to be, as the sequence name is an internal identifier that does not appear in the GenBank view in Entrez.</p>
</li>
<li>
<p>Update</p>
<p>Check this box if the sequence is an update to an existing accession number, and type the number in the box. Do not check this box if you are preparing a new submission.</p>
</li>
<li>
<p>Chromosome</p>
<p>The chromosome number will appear as a /chromosome qualifier in the source feature.</p>
</li>
<li>
<p>Clone</p>
<p>The clone name will appear as a /clone qualifier in the source feature. This name may be the same as the sequence name.</p>
</li>
<li>
<p>Secondary Accessions</p>
<p>In some cases, a large segment will supercede another group of shorter segments with different accession numbers. These shorter records are then no longer needed as independent entries in GenBank and should be made secondary. Use this spreadsheet field to list the accession numbers, one per line, which should be made secondary to the sequence in the record (the primary sequence). The NCBI will then remove the records containing those accession number(s) from GenBank, and they will no longer be part of the GenBank release. They will nonetheless be available from Entrez, as secondary accession numbers are listed in the Accession field of the GenBank flatfile after the primary accession number.</p>
<p>Please take great care when using this field!!! The NCBI does not check that the sequence of the primary and secondary accession numbers overlaps. A mistake on your part will result in the wrong sequence being withdrawn from GenBank, EMBL, and DDBJ. We provide this parameter as a convenience to submitting centers, but this parameter will be removed if it is not used carefully.</p>
</li>
<li>
<p>Title</p>
<p>Use this box to enter the title of the sequence for Phase 3 sequences. This text will appear in the definition line of the GenBank flatfile. If there was a title on the first line of the FASTA-formatted sequence, that title will be automatically entered into this box where it can be edited if necessary. However, it will be overwritten by the entry's source information in the case of Phase 0, 1, and 2 submissions. For these unfinished HTGs, the organism, chromosome, map, and clone information that has been entered into the correct fields, together with the phase and number of pieces, will automatically be used to generate the definition line during processing of the submission. Sample DEFINITION lines are shown in the HTG <a href="/genbank/htgs/faq">FAQ</a>.</p>
</li>
<li>
<p>Remark</p>
<p>Any text entered into this box will become a Comment descriptor on the record. For Phase 1 and 2 HTGs, information about the Phase, gaps, and order of contigs will be automatically added to the Comment descriptor.</p>
</li>
</ul>
<h2 id="after-using-sequin">After Using Sequin</h2>
<p>When you are finished with the submission, deposit it on your <a href="/genbank/htgs/ftp">FTP account</a> under the "SEQSUBMIT" directory. Our software will look for it there every day, validate the center and sequence_name id's, check if the record is an update, and write a report that you can pick up the next day. Further information about how HTG records are processed is available from <a href="/genbank/htgs/processing">www.ncbi.nlm.nih.gov/HTGS/processing.html</a>.</p>
</div>
<!--/.col1-->
<div class="col2">
<div class="rightnav">
<h2 id="htgs-resources">HTGs Resources</h2>
<ul>
<li><a href="/genbank/htgs">About HTGs</a></li>
<li><a href="/genbank/htgs/subinfo">Submitting HTGs</a></li>
<li><a href="/genbank/htgs/faq">HTGs FAQ</a></li>
</ul>
</div>
</div>
<!--/.col2-->
<div class="col3">
</div>
<!--/.col3-->
<div class="col4">
</div>
<!--/.col4-->
<div class="col5">
</div>
<div class="col6">
</div>
<div class="col7">
</div>
<div class="col8">
</div>
<div class="col9">
</div>
</div><!--/.content-->
</div><!--/.container-->
<div id="NCBIFooter_dynamic">
<div class="breadcrumbs">You are here:
<span id="breadcrumb_text"><a href="/guide/">NCBI</a></span></div>
<a id="help-desk-link" class="help_desk" href="https://support.ncbi.nlm.nih.gov/ics/support/default.asp?Time=2025-03-05T16:30:20-05:00&amp;Snapshot=%2Fprojects%2Fstaticsites%2Fgenbank%2Fgenbank@2.21&amp;Host=portal107&amp;ncbi_phid=CE8EFDBB7C8B97E10000000000FA00D0&amp;ncbi_session=CE8B5AF87C7FFCB1_0191SID&amp;from=https%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fgenbank%2Fhtgs%2Fsequininfo%2F&amp;Ncbi_App=genbank&amp;Page=custom-page&amp;style=classic&amp;deptID=28049" target="_blank">Support Center</a>
<noscript><img alt="" src="/stat?jsdisabled=true&amp;ncbi_app=genbank&amp;ncbi_db=&amp;ncbi_pdid=custom-page&amp;ncbi_phid=CE8EFDBB7C8B97E10000000000FA00D0" /></noscript>
</div>
<div xmlns:xi="http://www.w3.org/2001/XInclude">
<div xmlns="http://www.w3.org/1999/xhtml" class="footer" id="footer" xml:base="http://127.0.0.1/sites/static/header_footer">
<section class="icon-section">
<div id="icon-section-header" class="icon-section_header">Follow NCBI</div>
<div class="grid-container container">
<div class="icon-section_container">
<a class="footer-icon" id="footer_twitter" href="https://twitter.com/ncbi" aria-label="Twitter">
<svg xmlns="http://www.w3.org/2000/svg" width="40" height="40" viewBox="0 0 40 40" fill="none">
<title>Twitter</title>
<g id="twitterx1008">
<path id="path1008" d="M6.06736 7L16.8778 20.8991L6.00001 32.2H10.2L18.6 23.1L25.668 32.2H34L22.8 17.5L31.9 7H28.4L20.7 15.4L14.401 7H6.06898H6.06736ZM9.66753 8.73423H12.9327L29.7327 30.4658H26.5697L9.66753 8.73423Z" fill="#5B616B"></path>
</g>
</svg>
</a>
<a class="footer-icon" id="footer_facebook" href="https://www.facebook.com/ncbi.nlm" aria-label="Facebook"><svg xmlns="http://www.w3.org/2000/svg" data-name="Layer 1" viewBox="0 0 300 300">
<title>Facebook</title>
<path class="cls-11" d="M210.5,115.12H171.74V97.82c0-8.14,5.39-10,9.19-10h27.14V52l-39.32-.12c-35.66,0-42.42,26.68-42.42,43.77v19.48H99.09v36.32h27.24v109h45.41v-109h35Z">
</path>
</svg></a>
<a class="footer-icon" id="footer_linkedin" href="https://www.linkedin.com/company/ncbinlm" aria-label="LinkedIn"><svg xmlns="http://www.w3.org/2000/svg" data-name="Layer 1" viewBox="0 0 300 300">
<title>LinkedIn</title>
<path class="cls-11" d="M101.64,243.37H57.79v-114h43.85Zm-22-131.54h-.26c-13.25,0-21.82-10.36-21.82-21.76,0-11.65,8.84-21.15,22.33-21.15S101.7,78.72,102,90.38C102,101.77,93.4,111.83,79.63,111.83Zm100.93,52.61A17.54,17.54,0,0,0,163,182v61.39H119.18s.51-105.23,0-114H163v13a54.33,54.33,0,0,1,34.54-12.66c26,0,44.39,18.8,44.39,55.29v58.35H198.1V182A17.54,17.54,0,0,0,180.56,164.44Z">
</path>
</svg></a>
<a class="footer-icon" id="footer_github" href="https://github.com/ncbi" aria-label="GitHub"><svg xmlns="http://www.w3.org/2000/svg" data-name="Layer 1" viewBox="0 0 300 300">
<defs>
<style>
.cls-11,
.cls-12 {
fill: #737373;
}
.cls-11 {
fill-rule: evenodd;
}
</style>
</defs>
<title>GitHub</title>
<path class="cls-11" d="M151.36,47.28a105.76,105.76,0,0,0-33.43,206.1c5.28,1,7.22-2.3,7.22-5.09,0-2.52-.09-10.85-.14-19.69-29.42,6.4-35.63-12.48-35.63-12.48-4.81-12.22-11.74-15.47-11.74-15.47-9.59-6.56.73-6.43.73-6.43,10.61.75,16.21,10.9,16.21,10.9,9.43,16.17,24.73,11.49,30.77,8.79,1-6.83,3.69-11.5,6.71-14.14C108.57,197.1,83.88,188,83.88,147.51a40.92,40.92,0,0,1,10.9-28.39c-1.1-2.66-4.72-13.42,1-28,0,0,8.88-2.84,29.09,10.84a100.26,100.26,0,0,1,53,0C198,88.3,206.9,91.14,206.9,91.14c5.76,14.56,2.14,25.32,1,28a40.87,40.87,0,0,1,10.89,28.39c0,40.62-24.74,49.56-48.29,52.18,3.79,3.28,7.17,9.71,7.17,19.58,0,14.15-.12,25.54-.12,29,0,2.82,1.9,6.11,7.26,5.07A105.76,105.76,0,0,0,151.36,47.28Z">
</path>
<path class="cls-12" d="M85.66,199.12c-.23.52-1.06.68-1.81.32s-1.2-1.06-.95-1.59,1.06-.69,1.82-.33,1.21,1.07.94,1.6Zm-1.3-1">
</path>
<path class="cls-12" d="M90,203.89c-.51.47-1.49.25-2.16-.49a1.61,1.61,0,0,1-.31-2.19c.52-.47,1.47-.25,2.17.49s.82,1.72.3,2.19Zm-1-1.08">
</path>
<path class="cls-12" d="M94.12,210c-.65.46-1.71,0-2.37-.91s-.64-2.07,0-2.52,1.7,0,2.36.89.65,2.08,0,2.54Zm0,0"></path>
<path class="cls-12" d="M99.83,215.87c-.58.64-1.82.47-2.72-.41s-1.18-2.06-.6-2.7,1.83-.46,2.74.41,1.2,2.07.58,2.7Zm0,0">
</path>
<path class="cls-12" d="M107.71,219.29c-.26.82-1.45,1.2-2.64.85s-2-1.34-1.74-2.17,1.44-1.23,2.65-.85,2,1.32,1.73,2.17Zm0,0">
</path>
<path class="cls-12" d="M116.36,219.92c0,.87-1,1.59-2.24,1.61s-2.29-.68-2.3-1.54,1-1.59,2.26-1.61,2.28.67,2.28,1.54Zm0,0">
</path>
<path class="cls-12" d="M124.42,218.55c.15.85-.73,1.72-2,1.95s-2.37-.3-2.52-1.14.73-1.75,2-2,2.37.29,2.53,1.16Zm0,0"></path>
</svg></a>
<a class="footer-icon" id="footer_blog" href="https://ncbiinsights.ncbi.nlm.nih.gov/" aria-label="Blog">
<svg xmlns="http://www.w3.org/2000/svg" id="Layer_1" data-name="Layer 1" viewBox="0 0 40 40">
<defs><style>.cls-1{fill:#737373;}</style></defs>
<title>NCBI Insights Blog</title>
<path class="cls-1" d="M14,30a4,4,0,1,1-4-4,4,4,0,0,1,4,4Zm11,3A19,19,0,0,0,7.05,15a1,1,0,0,0-1,1v3a1,1,0,0,0,.93,1A14,14,0,0,1,20,33.07,1,1,0,0,0,21,34h3a1,1,0,0,0,1-1Zm9,0A28,28,0,0,0,7,6,1,1,0,0,0,6,7v3a1,1,0,0,0,1,1A23,23,0,0,1,29,33a1,1,0,0,0,1,1h3A1,1,0,0,0,34,33Z"></path>
</svg>
</a>
</div>
</div>
</section>
<section class="container-fluid bg-primary">
<div class="container pt-5">
<div class="row mt-3">
<div class="col-lg-3 col-12">
<p><a class="text-white" href="https://www.nlm.nih.gov/socialmedia/index.html">Connect with NLM</a></p>
<ul class="list-inline social_media">
<li class="list-inline-item"><a href="https://twitter.com/NLM_NIH" aria-label="Twitter" target="_blank" rel="noopener noreferrer">
<svg xmlns="http://www.w3.org/2000/svg" width="35" height="35" viewBox="0 0 36 35" fill="none">
<title>Twitter</title>
<g id="twitterx1009" clip-path="url(#clip0_65276_3946)">
<path id="Vector_Twitter" d="M17.5006 34.6565C26.9761 34.6565 34.6575 26.9751 34.6575 17.4996C34.6575 8.02416 26.9761 0.342773 17.5006 0.342773C8.02514 0.342773 0.34375 8.02416 0.34375 17.4996C0.34375 26.9751 8.02514 34.6565 17.5006 34.6565Z" fill="#205493" stroke="white" stroke-width="1.0" stroke-miterlimit="10"></path>
<path id="path1009" d="M8.54811 8.5L16.2698 18.4279L8.50001 26.5H11.5L17.5 20L22.5486 26.5H28.5L20.5 16L27 8.5H24.5L19 14.5L14.5007 8.5H8.54927H8.54811ZM11.1197 9.73873H13.4519L25.4519 25.2613H23.1926L11.1197 9.73873Z" fill="white"></path>
</g>
<defs>
<clipPath id="clip0_65276_3946">
<rect width="35" height="35" fill="white"></rect>
</clipPath>
</defs>
</svg>
</a></li>
<li class="list-inline-item"><a href="https://www.facebook.com/nationallibraryofmedicine" aria-label="Facebook" rel="noopener noreferrer" target="_blank">
<svg xmlns="http://www.w3.org/2000/svg" width="35" height="35" viewBox="0 0 36 35" fill="none">
<title>Facebook</title>
<g id="Facebook" clip-path="url(#clip0_1717_1086)">
<path id="Vector_Facebook" d="M15.1147 29.1371C15.1147 29.0822 15.1147 29.0296 15.1147 28.9747V18.9414H11.8183C11.6719 18.9414 11.6719 18.9414 11.6719 18.8018C11.6719 17.5642 11.6719 16.3289 11.6719 15.0937C11.6719 14.9793 11.7062 14.9518 11.816 14.9518C12.8683 14.9518 13.9206 14.9518 14.9751 14.9518H15.1215V14.8329C15.1215 13.8057 15.1215 12.774 15.1215 11.7492C15.1274 10.9262 15.3148 10.1146 15.6706 9.37241C16.1301 8.38271 16.9475 7.60378 17.9582 7.19235C18.6492 6.90525 19.3923 6.76428 20.1405 6.7783C21.0029 6.79202 21.8653 6.83091 22.7278 6.86065C22.8879 6.86065 23.048 6.89496 23.2082 6.90182C23.2974 6.90182 23.3271 6.94071 23.3271 7.02993C23.3271 7.54235 23.3271 8.05477 23.3271 8.5649C23.3271 9.16882 23.3271 9.77274 23.3271 10.3767C23.3271 10.4819 23.2974 10.5139 23.1921 10.5116C22.5379 10.5116 21.8814 10.5116 21.2271 10.5116C20.9287 10.5184 20.6316 10.5528 20.3395 10.6146C20.0822 10.6619 19.8463 10.7891 19.6653 10.9779C19.4842 11.1668 19.3672 11.4078 19.3307 11.6669C19.2857 11.893 19.2612 12.1226 19.2575 12.3531C19.2575 13.1904 19.2575 14.0299 19.2575 14.8695C19.2575 14.8946 19.2575 14.9198 19.2575 14.9564H23.0229C23.1807 14.9564 23.183 14.9564 23.1624 15.1074C23.0778 15.7662 22.9885 16.425 22.9039 17.0816C22.8322 17.6321 22.7636 18.1827 22.698 18.7332C22.6729 18.9437 22.6797 18.9437 22.4693 18.9437H19.2644V28.8992C19.2644 28.9793 19.2644 29.0593 19.2644 29.1394L15.1147 29.1371Z" fill="white"></path>
<path id="Vector_2_Facebook" d="M17.5006 34.657C26.9761 34.657 34.6575 26.9756 34.6575 17.5001C34.6575 8.02465 26.9761 0.343262 17.5006 0.343262C8.02514 0.343262 0.34375 8.02465 0.34375 17.5001C0.34375 26.9756 8.02514 34.657 17.5006 34.657Z" stroke="white" stroke-width="1.0" stroke-miterlimit="10"></path>
</g>
<defs>
<clipPath id="clip0_1717_1086">
<rect width="35" height="35" fill="white"></rect>
</clipPath>
</defs>
</svg>
</a></li>
<li class="list-inline-item"><a href="https://www.youtube.com/user/NLMNIH" aria-label="Youtube" target="_blank" rel="noopener noreferrer">
<svg xmlns="http://www.w3.org/2000/svg" width="35" height="35" viewBox="0 0 36 35" fill="none">
<title>Youtube</title>
<g id="YouTube" clip-path="url(#clip0_1717_1101)">
<path id="Vector_Youtube" d="M26.2571 11.4791C25.9025 11.1589 25.5709 10.9576 24.228 10.834C22.5512 10.6785 20.2797 10.6556 18.564 10.6533H16.4365C14.7208 10.6533 12.4493 10.6785 10.7725 10.834C9.43196 10.9576 9.09798 11.1589 8.7434 11.4791C7.81464 12.321 7.6202 14.6268 7.59961 16.8938C7.59961 17.3178 7.59961 17.741 7.59961 18.1635C7.62706 20.4121 7.82837 22.686 8.7434 23.521C9.09798 23.8412 9.42967 24.0425 10.7725 24.1661C12.4493 24.3216 14.7208 24.3445 16.4365 24.3468H18.564C20.2797 24.3468 22.5512 24.3216 24.228 24.1661C25.5686 24.0425 25.9025 23.8412 26.2571 23.521C27.1722 22.6929 27.3735 20.451 27.4009 18.2206C27.4009 17.7402 27.4009 17.2599 27.4009 16.7795C27.3735 14.5491 27.1699 12.3072 26.2571 11.4791ZM15.5604 20.5311V14.652L20.561 17.5001L15.5604 20.5311Z" fill="white"></path>
<path id="Vector_2_Youtube" d="M17.5006 34.657C26.9761 34.657 34.6575 26.9756 34.6575 17.5001C34.6575 8.02465 26.9761 0.343262 17.5006 0.343262C8.02514 0.343262 0.34375 8.02465 0.34375 17.5001C0.34375 26.9756 8.02514 34.657 17.5006 34.657Z" stroke="white" stroke-width="1.0" stroke-miterlimit="10"></path>
</g>
<defs>
<clipPath id="clip0_1717_1101">
<rect width="35" height="35" fill="white"></rect>
</clipPath>
</defs>
</svg>
</a></li>
</ul>
</div>
<div class="col-lg-3 col-12">
<p class="address_footer text-white">National Library of Medicine<br />
<a href="https://www.google.com/maps/place/8600+Rockville+Pike,+Bethesda,+MD+20894/@38.9959508,-77.101021,17z/data=!3m1!4b1!4m5!3m4!1s0x89b7c95e25765ddb:0x19156f88b27635b8!8m2!3d38.9959508!4d-77.0988323" class="text-white" target="_blank" rel="noopener noreferrer">8600 Rockville Pike<br />
Bethesda, MD 20894</a></p>
</div>
<div class="col-lg-3 col-12 centered-lg">
<p><a href="https://www.nlm.nih.gov/web_policies.html" class="text-white">Web Policies</a><br />
<a href="https://www.nih.gov/institutes-nih/nih-office-director/office-communications-public-liaison/freedom-information-act-office" class="text-white">FOIA</a><br />
<a href="https://www.hhs.gov/vulnerability-disclosure-policy/index.html" class="text-white" id="vdp">HHS Vulnerability Disclosure</a></p>
</div>
<div class="col-lg-3 col-12 centered-lg">
<p><a class="supportLink text-white" href="https://support.nlm.nih.gov/">Help</a><br />
<a href="https://www.nlm.nih.gov/accessibility.html" class="text-white">Accessibility</a><br />
<a href="https://www.nlm.nih.gov/careers/careers.html" class="text-white">Careers</a></p>
</div>
</div>
<div class="row">
<div class="col-lg-12 centered-lg">
<nav class="bottom-links">
<ul class="mt-3">
<li>
<a class="text-white" href="//www.nlm.nih.gov/">NLM</a>
</li>
<li>
<a class="text-white" href="https://www.nih.gov/">NIH</a>
</li>
<li>
<a class="text-white" href="https://www.hhs.gov/">HHS</a>
</li>
<li>
<a class="text-white" href="https://www.usa.gov/">USA.gov</a>
</li>
</ul>
</nav>
</div>
</div>
</div>
</section>
<script type="text/javascript" src="/portal/portal3rc.fcgi/rlib/js/InstrumentOmnitureBaseJS/InstrumentNCBIConfigJS/InstrumentNCBIBaseJS/InstrumentPageStarterJS.js?v=1"> </script>
<script type="text/javascript" src="/portal/portal3rc.fcgi/static/js/hfjs2.js"> </script>
</div>
</div>
<!--/.footer-->
<p class="last-updated small">Last updated: 2017-11-20T22:51:52Z</p>
</div>
<!--/.page-->
</div>
<!--/.wrap-->
<span class="PAFAppResources"></span>
</div><!-- /.twelve_col -->
</div>
<!-- /.grid -->
<!-- usually for JS scripts at page bottom -->
<span class="pagefixtures"></span>
<!-- CE8B5AF87C7FFCB1_0191SID /projects/staticsites/genbank/genbank@2.21 portal107 v4.1.r689238 Tue, Oct 22 2024 16:10:51 -->
<span id="portal-csrf-token" style="display:none" data-token="CE8B5AF87C7FFCB1_0191SID"></span>
<script type="text/javascript" src="//static.pubmed.gov/portal/portal3rc.fcgi/4218137/js/3879255/4121861/1490097/4087685.js" snapshot="genbank"></script></body>
</html>
Reference in a new issue View git blame Copy permalink